problems splitting

classic Classic list List threaded Threaded
15 messages Options
Reply | Threaded
Open this post in threaded view
|

problems splitting

Roberto Alonso CIPF
Hello,

I am trying to map a a fastqsacer file and map it with bwa, my bwa tool config file is this:

<tool id="bwa_mio" name="map with bwa">
  <description>map with bwa</description>
  <parallelism method="basic" split_size="2" split_mode="number_of_parts"></parallelism>

  <command>
      bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa $input > $output 2>xx</command>
  <inputs>
    <param format="fastqsanger" name="input" type="data" label="fastq"/>
  </inputs>
  <outputs>
      <data format="sam" name="output" />
  </outputs>

  <help>
  bwa
  </help>

</tool>


And when I see the stderr I see this error:
type object 'Sequence' has no attribute 'get_split_commands_sequential'

It seems that this command that I see in the log is not working
galaxy.jobs.runners DEBUG 2015-02-11 16:33:48,738 (74) command is: /home/ralonso/galaxy-dist/extract_dataset_parts.sh /home/ralonso/galaxy-dist/database/job_working_directory/000/74/task_0; bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/job_working_directory/000/74/task_0/dataset_8.dat > /home/ralonso/galaxy-dist/database/job_working_directory/000/74/task_0/dataset_75.dat

When I go directly to the code, around line 559 of class galaxy.datatypes.sequence I can't find this function  get_split_commands_sequential anywhere.
Any idea?

Thank you very much

Regards

--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]

___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Peter Cock
Hi Roberto,

It looks like this is a known issue with FASTQ splitting,
https://trello.com/c/qRHLFSzd/1522-issues-with-tasked-jobs-parallelism

I originally broke it during a refactor, but it looks like the
discussion died about that that method was meant to do
(e.g. FQTOC = FASTQ table of contents?):

https://bitbucket.org/galaxy/galaxy-central/commits/76277761807306ec2be3f1e4059dd7cde6fd2dc6#comment-820648

I'm away from the office so can't try this, but probably all
that is needed is to copy and paste the old method
get_split_commands_sequential and the old method
get_split_commands_with_toc (removed from the
base Sequence class in the above commit) into the
base Fastq class instead.

Nicola - did you fix this locally after noticing the
problem last year?

Peter

On Wed, Feb 11, 2015 at 3:45 PM, Roberto Alonso CIPF <[hidden email]> wrote:

> Hello,
>
> I am trying to map a a fastqsacer file and map it with bwa, my bwa tool
> config file is this:
>
> <tool id="bwa_mio" name="map with bwa">
>   <description>map with bwa</description>
>   <parallelism method="basic" split_size="2"
> split_mode="number_of_parts"></parallelism>
>
>   <command>
>       bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
> $input > $output 2>xx</command>
>   <inputs>
>     <param format="fastqsanger" name="input" type="data" label="fastq"/>
>   </inputs>
>   <outputs>
>       <data format="sam" name="output" />
>   </outputs>
>
>   <help>
>   bwa
>   </help>
>
> </tool>
>
>
> And when I see the stderr I see this error:
> type object 'Sequence' has no attribute 'get_split_commands_sequential'
>
> It seems that this command that I see in the log is not working
> galaxy.jobs.runners DEBUG 2015-02-11 16:33:48,738 (74) command is:
> /home/ralonso/galaxy-dist/extract_dataset_parts.sh
> /home/ralonso/galaxy-dist/database/job_working_directory/000/74/task_0; bwa
> mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
> /home/ralonso/galaxy-dist/database/job_working_directory/000/74/task_0/dataset_8.dat
>>
> /home/ralonso/galaxy-dist/database/job_working_directory/000/74/task_0/dataset_75.dat
>
> When I go directly to the code, around line 559 of class
> galaxy.datatypes.sequence I can't find this function
> get_split_commands_sequential anywhere.
> Any idea?
>
> Thank you very much
>
> Regards
>
> --
> Roberto Alonso
> Functional Genomics Unit
> Bioinformatics and Genomics Department
> Prince Felipe Research Center (CIPF)
> C./Eduardo Primo Yúfera (Científic), nº 3
> (junto Oceanografico)
> 46012 Valencia, Spain
> Tel: +34 963289680 Ext. 1021
> Fax: +34 963289574
> E-Mail: [hidden email]
>
> ___________________________________________________________
> Please keep all replies on the list by using "reply all"
> in your mail client.  To manage your subscriptions to this
> and other Galaxy lists, please use the interface at:
>   https://lists.galaxyproject.org/
>
> To search Galaxy mailing lists use the unified search at:
>   http://galaxyproject.org/search/mailinglists/
___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Nicola Soranzo-2
Il 13.02.2015 03:17 Peter Cock ha scritto:

> Hi Roberto,
>
> It looks like this is a known issue with FASTQ splitting,
>
> https://trello.com/c/qRHLFSzd/1522-issues-with-tasked-jobs-parallelism
>
> I originally broke it during a refactor, but it looks like the
> discussion died about that that method was meant to do
> (e.g. FQTOC = FASTQ table of contents?):
>
>
https://bitbucket.org/galaxy/galaxy-central/commits/76277761807306ec2be3f1e4059dd7cde6fd2dc6#comment-820648

>
> I'm away from the office so can't try this, but probably all
> that is needed is to copy and paste the old method
> get_split_commands_sequential and the old method
> get_split_commands_with_toc (removed from the
> base Sequence class in the above commit) into the
> base Fastq class instead.
>
> Nicola - did you fix this locally after noticing the
> problem last year?

No, sorry, we disabled Galaxy parallelism because it was using too many
cluster nodes.

Nicola

> Peter
>
> On Wed, Feb 11, 2015 at 3:45 PM, Roberto Alonso CIPF wrote:
>
>> Hello, I am trying to map a a fastqsanger file and map it with bwa,
>> my
>> bwa tool config file is this:map with bwabwa mem
>> /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa $input >
>> $output 2>xxbwaAnd when I see the stderr I see this error: type
>> object
>> 'Sequence' has no attribute 'get_split_commands_sequential' It seems
>> that this command that I see in the log is not working
>> galaxy.jobs.runners DEBUG 2015-02-11 16:33:48,738 (74) command is:
>> /home/ralonso/galaxy-dist/extract_dataset_parts.sh
>>
>> /home/ralonso/galaxy-dist/database/job_working_directory/000/74/task_0;
>> bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
>>
>
/home/ralonso/galaxy-dist/database/job_working_directory/000/74/task_0/dataset_8.dat/home/ralonso/galaxy-dist/database/job_working_directory/000/74/task_0/dataset_75.dat

>> When I go directly to the code, around line 559 of class
>> galaxy.datatypes.sequence I can't find this function
>> get_split_commands_sequential anywhere. Any idea? Thank you very
>> much
>> Regards -- Roberto Alonso Functional Genomics Unit Bioinformatics
>> and
>> Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo
>> Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia,
>> Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail:
>> [hidden email]
>> ___________________________________________________________ Please
>> keep
>> all replies on the list by using "reply all" in your mail client. To
>> manage your subscriptions to this and other Galaxy lists, please use
>> the interface at: https://lists.galaxyproject.org/ To search Galaxy
>> mailing lists use the unified search at:
>> http://galaxyproject.org/search/mailinglists/
>
> ___________________________________________________________
> Please keep all replies on the list by using "reply all"
> in your mail client. To manage your subscriptions to this
> and other Galaxy lists, please use the interface at:
> https://lists.galaxyproject.org/
>
> To search Galaxy mailing lists use the unified search at:
> http://galaxyproject.org/search/mailinglists/


Connetti gratis il mondo con la nuova indoona:  hai la chat, le
chiamate, le video chiamate e persino le chiamate di gruppo.
E chiami gratis anche i numeri fissi e mobili nel mondo!
Scarica subito l’app Vai su https://www.indoona.com/


___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Peter Cock
On Fri, Feb 13, 2015 at 11:38 AM, Nicola Soranzo <[hidden email]> wrote:

> Il 13.02.2015 03:17 Peter Cock ha scritto:
>>
>> Hi Roberto,
>>
>> It looks like this is a known issue with FASTQ splitting,
>>
>> https://trello.com/c/qRHLFSzd/1522-issues-with-tasked-jobs-parallelism
>>
>> I originally broke it during a refactor, but it looks like the
>> discussion died about that that method was meant to do
>> (e.g. FQTOC = FASTQ table of contents?):
>>
>>
>> https://bitbucket.org/galaxy/galaxy-central/commits/76277761807306ec2be3f1e4059dd7cde6fd2dc6#comment-820648
>>
>> I'm away from the office so can't try this, but probably all
>> that is needed is to copy and paste the old method
>> get_split_commands_sequential and the old method
>> get_split_commands_with_toc (removed from the
>> base Sequence class in the above commit) into the
>> base Fastq class instead.
>>
>> Nicola - did you fix this locally after noticing the
>> problem last year?
>
> No, sorry, we disabled Galaxy parallelism because it was using
> too many cluster nodes.
>
> Nicola

I had similar comments from some of the cluster users
after getting it working here - but on balance a well used
cluster helps justify future investment in maintaining it.

Sorry about not following up on this - I think I might have
assumed you would take care of it. Unfortunately I won't
be able to test the obvious fix until at least a week later...

Peter
___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Roberto Alonso CIPF
Hello again,

first of all thanks for your help, it is being very useful. 

What I have done up to now is to copy this method to the class Sequence

def get_split_commands_sequential(is_compressed, input_name, output_name, start_sequence, sequence_count):
        """
        Does a brain-dead sequential scan & extract of certain sequences
        >>> Sequence.get_split_commands_sequential(True, './input.gz', './output.gz', start_sequence=0, sequence_count=10)
        ['zcat "./input.gz" | ( tail -n +1 2> /dev/null) | head -40 | gzip -c > "./output.gz"']
        >>> Sequence.get_split_commands_sequential(False, './input.fastq', './output.fastq', start_sequence=10, sequence_count=10)
        ['tail -n +41 "./input.fastq" 2> /dev/null | head -40 > "./output.fastq"']
        """
        start_line = start_sequence * 4
        line_count = sequence_count * 4
        # TODO: verify that tail can handle 64-bit numbers
        if is_compressed:
            cmd = 'zcat "%s" | ( tail -n +%s 2> /dev/null) | head -%s | gzip -c' % (input_name, start_line+1, line_count)
        else:
            cmd = 'tail -n +%s "%s" 2> /dev/null | head -%s'  % (start_line+1, input_name, line_count)
        cmd += ' > "%s"' % output_name

        return [cmd]
    get_split_commands_sequential = staticmethod(get_split_commands_sequential)

This is something that you suggested. 
When I run the tool with this configuration:

<tool id="bwa_mio" name="map with bwa">
  <description>map with bwa</description>
  <parallelism method="basic" split_size="3" split_mode="number_of_parts"></parallelism>

  <command>
      bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa $input > $output 2>/dev/null</command>
  <inputs>
    <param format="fastqsanger" name="input" type="data" label="fastq"/>
  </inputs>
  <outputs>
      <data format="sam" name="output" />
  </outputs>

  <help>
  bwa
  </help>

</tool>
Everything ends ok, but when I go to check how is the sam, I see that in the alingments it is the path of the file, i.e
example_split.sam:
/home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446 4 * 0 0 * * 0 0 TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT ############################################################################ AS:i:0 XS:i:0

you know what  may be going on?
If i don't split the file, everything goes correctly.

Best regards


On 13 February 2015 at 13:39, Peter Cock <[hidden email]> wrote:
On Fri, Feb 13, 2015 at 11:38 AM, Nicola Soranzo <[hidden email]> wrote:
> Il 13.02.2015 03:17 Peter Cock ha scritto:
>>
>> Hi Roberto,
>>
>> It looks like this is a known issue with FASTQ splitting,
>>
>> https://trello.com/c/qRHLFSzd/1522-issues-with-tasked-jobs-parallelism
>>
>> I originally broke it during a refactor, but it looks like the
>> discussion died about that that method was meant to do
>> (e.g. FQTOC = FASTQ table of contents?):
>>
>>
>> https://bitbucket.org/galaxy/galaxy-central/commits/76277761807306ec2be3f1e4059dd7cde6fd2dc6#comment-820648
>>
>> I'm away from the office so can't try this, but probably all
>> that is needed is to copy and paste the old method
>> get_split_commands_sequential and the old method
>> get_split_commands_with_toc (removed from the
>> base Sequence class in the above commit) into the
>> base Fastq class instead.
>>
>> Nicola - did you fix this locally after noticing the
>> problem last year?
>
> No, sorry, we disabled Galaxy parallelism because it was using
> too many cluster nodes.
>
> Nicola

I had similar comments from some of the cluster users
after getting it working here - but on balance a well used
cluster helps justify future investment in maintaining it.

Sorry about not following up on this - I think I might have
assumed you would take care of it. Unfortunately I won't
be able to test the obvious fix until at least a week later...

Peter



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]

___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Peter Cock
On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF <[hidden email]> wrote:

> Hello again,
>
> first of all thanks for your help, it is being very useful.
>
> What I have done up to now is to copy this method to the class Sequence
>
> def get_split_commands_sequential(is_compressed, input_name, output_name,
> start_sequence, sequence_count):
>         ...
>         return [cmd]
>     get_split_commands_sequential =
> staticmethod(get_split_commands_sequential)
>
> This is something that you suggested.

Good.

> When I run the tool with this configuration:
>
> <tool id="bwa_mio" name="map with bwa">
>   <description>map with bwa</description>
>   <parallelism method="basic" split_size="3"
> split_mode="number_of_parts"></parallelism>
>
>   <command>
>       bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
> $input > $output 2>/dev/null</command>
>   <inputs>
>     <param format="fastqsanger" name="input" type="data" label="fastq"/>
>   </inputs>
>   <outputs>
>       <data format="sam" name="output" />
>   </outputs>
>
>   <help>
>   bwa
>   </help>
>
> </tool>

One minor improvement would be to escape the ">" as "&gt;" in
your XML, or use the CDATA approach documented here:

https://wiki.galaxyproject.org/Tools/BestPractices

> Everything ends ok, but when I go to check how is the sam, I see that in the
> alingments it is the path of the file, i.e
> example_split.sam:
> /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446
> 4 * 0 0 * * 0 0
> TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT
> ############################################################################
> AS:i:0 XS:i:0
>
> you know what  may be going on?
> If i don't split the file, everything goes correctly.

This sounds to me like there may be a problem with SAM merging?
Could you share the entire example_split.sam file (e.g. as a gist
on GitHub, or via dropbox)?

Peter
___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Roberto Alonso CIPF
Hello,

I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file:

Best regards

On 24 February 2015 at 17:49, Peter Cock <[hidden email]> wrote:
On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF <[hidden email]> wrote:
> Hello again,
>
> first of all thanks for your help, it is being very useful.
>
> What I have done up to now is to copy this method to the class Sequence
>
> def get_split_commands_sequential(is_compressed, input_name, output_name,
> start_sequence, sequence_count):
>         ...
>         return [cmd]
>     get_split_commands_sequential =
> staticmethod(get_split_commands_sequential)
>
> This is something that you suggested.

Good.

> When I run the tool with this configuration:
>
> <tool id="bwa_mio" name="map with bwa">
>   <description>map with bwa</description>
>   <parallelism method="basic" split_size="3"
> split_mode="number_of_parts"></parallelism>
>
>   <command>
>       bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
> $input > $output 2>/dev/null</command>
>   <inputs>
>     <param format="fastqsanger" name="input" type="data" label="fastq"/>
>   </inputs>
>   <outputs>
>       <data format="sam" name="output" />
>   </outputs>
>
>   <help>
>   bwa
>   </help>
>
> </tool>

One minor improvement would be to escape the ">" as "&gt;" in
your XML, or use the CDATA approach documented here:

https://wiki.galaxyproject.org/Tools/BestPractices

> Everything ends ok, but when I go to check how is the sam, I see that in the
> alingments it is the path of the file, i.e
> example_split.sam:
> /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446
> 4 * 0 0 * * 0 0
> TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT
> ############################################################################
> AS:i:0 XS:i:0
>
> you know what  may be going on?
> If i don't split the file, everything goes correctly.

This sounds to me like there may be a problem with SAM merging?
Could you share the entire example_split.sam file (e.g. as a gist
on GitHub, or via dropbox)?

Peter



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]

___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Roberto Alonso CIPF
Hello again,

this is something that I consider important, when I see the log I see this output:
galaxy.jobs.runners.tasks DEBUG 2015-02-25 11:33:30,989 execution finished - beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null
I think the merge should be done with samtools. I don't know how is this programmed in Galaxy, but I didn't indicate anywhere the path to samtools, is it maybe the problem related with this?

Thanks a lot,

Regards


On 25 February 2015 at 11:13, Roberto Alonso CIPF <[hidden email]> wrote:
Hello,

I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file:

Best regards

On 24 February 2015 at 17:49, Peter Cock <[hidden email]> wrote:
On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF <[hidden email]> wrote:
> Hello again,
>
> first of all thanks for your help, it is being very useful.
>
> What I have done up to now is to copy this method to the class Sequence
>
> def get_split_commands_sequential(is_compressed, input_name, output_name,
> start_sequence, sequence_count):
>         ...
>         return [cmd]
>     get_split_commands_sequential =
> staticmethod(get_split_commands_sequential)
>
> This is something that you suggested.

Good.

> When I run the tool with this configuration:
>
> <tool id="bwa_mio" name="map with bwa">
>   <description>map with bwa</description>
>   <parallelism method="basic" split_size="3"
> split_mode="number_of_parts"></parallelism>
>
>   <command>
>       bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
> $input > $output 2>/dev/null</command>
>   <inputs>
>     <param format="fastqsanger" name="input" type="data" label="fastq"/>
>   </inputs>
>   <outputs>
>       <data format="sam" name="output" />
>   </outputs>
>
>   <help>
>   bwa
>   </help>
>
> </tool>

One minor improvement would be to escape the ">" as "&gt;" in
your XML, or use the CDATA approach documented here:

https://wiki.galaxyproject.org/Tools/BestPractices

> Everything ends ok, but when I go to check how is the sam, I see that in the
> alingments it is the path of the file, i.e
> example_split.sam:
> /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446
> 4 * 0 0 * * 0 0
> TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT
> ############################################################################
> AS:i:0 XS:i:0
>
> you know what  may be going on?
> If i don't split the file, everything goes correctly.

This sounds to me like there may be a problem with SAM merging?
Could you share the entire example_split.sam file (e.g. as a gist
on GitHub, or via dropbox)?

Peter



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]

___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Roberto Alonso CIPF
Ok, I think I understand the line:
beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null
it refers to the original command, so everything is fine with this line. The other problem still remains
Regards, sorry for the confusion

On 25 February 2015 at 11:40, Roberto Alonso CIPF <[hidden email]> wrote:
Hello again,

this is something that I consider important, when I see the log I see this output:
galaxy.jobs.runners.tasks DEBUG 2015-02-25 11:33:30,989 execution finished - beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null
I think the merge should be done with samtools. I don't know how is this programmed in Galaxy, but I didn't indicate anywhere the path to samtools, is it maybe the problem related with this?

Thanks a lot,

Regards


On 25 February 2015 at 11:13, Roberto Alonso CIPF <[hidden email]> wrote:
Hello,

I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file:

Best regards

On 24 February 2015 at 17:49, Peter Cock <[hidden email]> wrote:
On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF <[hidden email]> wrote:
> Hello again,
>
> first of all thanks for your help, it is being very useful.
>
> What I have done up to now is to copy this method to the class Sequence
>
> def get_split_commands_sequential(is_compressed, input_name, output_name,
> start_sequence, sequence_count):
>         ...
>         return [cmd]
>     get_split_commands_sequential =
> staticmethod(get_split_commands_sequential)
>
> This is something that you suggested.

Good.

> When I run the tool with this configuration:
>
> <tool id="bwa_mio" name="map with bwa">
>   <description>map with bwa</description>
>   <parallelism method="basic" split_size="3"
> split_mode="number_of_parts"></parallelism>
>
>   <command>
>       bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
> $input > $output 2>/dev/null</command>
>   <inputs>
>     <param format="fastqsanger" name="input" type="data" label="fastq"/>
>   </inputs>
>   <outputs>
>       <data format="sam" name="output" />
>   </outputs>
>
>   <help>
>   bwa
>   </help>
>
> </tool>

One minor improvement would be to escape the ">" as "&gt;" in
your XML, or use the CDATA approach documented here:

https://wiki.galaxyproject.org/Tools/BestPractices

> Everything ends ok, but when I go to check how is the sam, I see that in the
> alingments it is the path of the file, i.e
> example_split.sam:
> /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446
> 4 * 0 0 * * 0 0
> TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT
> ############################################################################
> AS:i:0 XS:i:0
>
> you know what  may be going on?
> If i don't split the file, everything goes correctly.

This sounds to me like there may be a problem with SAM merging?
Could you share the entire example_split.sam file (e.g. as a gist
on GitHub, or via dropbox)?

Peter



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]

___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Roberto Alonso CIPF
Hello again :),

I have found the problem, the code that merge the files is this:
galaxy/datatypes/tabular.py:484:            cmd = 'egrep -v "^@" %s >> %s' % ( ' '.join(split_files[1:]), output_file )
This concatenates the file name into the sam file. Just adding "h" it is enough, so it will be like this:
galaxy/datatypes/tabular.py:484:            cmd = 'egrep -hv "^@" %s >> %s' % ( ' '.join(split_files[1:]), output_file )

Thanks all for your help, best regards


On 25 February 2015 at 12:31, Roberto Alonso CIPF <[hidden email]> wrote:
Ok, I think I understand the line:
beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null
it refers to the original command, so everything is fine with this line. The other problem still remains
Regards, sorry for the confusion

On 25 February 2015 at 11:40, Roberto Alonso CIPF <[hidden email]> wrote:
Hello again,

this is something that I consider important, when I see the log I see this output:
galaxy.jobs.runners.tasks DEBUG 2015-02-25 11:33:30,989 execution finished - beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null
I think the merge should be done with samtools. I don't know how is this programmed in Galaxy, but I didn't indicate anywhere the path to samtools, is it maybe the problem related with this?

Thanks a lot,

Regards


On 25 February 2015 at 11:13, Roberto Alonso CIPF <[hidden email]> wrote:
Hello,

I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file:

Best regards

On 24 February 2015 at 17:49, Peter Cock <[hidden email]> wrote:
On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF <[hidden email]> wrote:
> Hello again,
>
> first of all thanks for your help, it is being very useful.
>
> What I have done up to now is to copy this method to the class Sequence
>
> def get_split_commands_sequential(is_compressed, input_name, output_name,
> start_sequence, sequence_count):
>         ...
>         return [cmd]
>     get_split_commands_sequential =
> staticmethod(get_split_commands_sequential)
>
> This is something that you suggested.

Good.

> When I run the tool with this configuration:
>
> <tool id="bwa_mio" name="map with bwa">
>   <description>map with bwa</description>
>   <parallelism method="basic" split_size="3"
> split_mode="number_of_parts"></parallelism>
>
>   <command>
>       bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
> $input > $output 2>/dev/null</command>
>   <inputs>
>     <param format="fastqsanger" name="input" type="data" label="fastq"/>
>   </inputs>
>   <outputs>
>       <data format="sam" name="output" />
>   </outputs>
>
>   <help>
>   bwa
>   </help>
>
> </tool>

One minor improvement would be to escape the ">" as "&gt;" in
your XML, or use the CDATA approach documented here:

https://wiki.galaxyproject.org/Tools/BestPractices

> Everything ends ok, but when I go to check how is the sam, I see that in the
> alingments it is the path of the file, i.e
> example_split.sam:
> /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446
> 4 * 0 0 * * 0 0
> TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT
> ############################################################################
> AS:i:0 XS:i:0
>
> you know what  may be going on?
> If i don't split the file, everything goes correctly.

This sounds to me like there may be a problem with SAM merging?
Could you share the entire example_split.sam file (e.g. as a gist
on GitHub, or via dropbox)?

Peter



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]

___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Nicola Soranzo-2
Hi Roberto,
I'm happy you solved your issue, thanks for sharing the solution!
I'd suggest you open a pull request with the fixes at https://github.com/galaxyproject/galaxy .

Cheers,
Nicola

Il 25.02.2015 15:07 Roberto Alonso CIPF ha scritto:

Hello again :),
I have found the problem, the code that merge the files is this:
galaxy/datatypes/tabular.py:484:            cmd = 'egrep -v "^@" %s >> %s' % ( ' '.join(split_files[1:]), output_file )
This concatenates the file name into the sam file. Just adding "h" it is enough, so it will be like this:
galaxy/datatypes/tabular.py:484:            cmd = 'egrep -hv "^@" %s >> %s' % ( ' '.join(split_files[1:]), output_file )
Thanks all for your help, best regards

On 25 February 2015 at 12:31, Roberto Alonso CIPF <[hidden email]> wrote:
Ok, I think I understand the line:
beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null
it refers to the original command, so everything is fine with this line. The other problem still remains
Regards, sorry for the confusion

On 25 February 2015 at 11:40, Roberto Alonso CIPF <[hidden email]> wrote:
Hello again,
this is something that I consider important, when I see the log I see this output:
galaxy.jobs.runners.tasks DEBUG 2015-02-25 11:33:30,989 execution finished - beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null
I think the merge should be done with samtools. I don't know how is this programmed in Galaxy, but I didn't indicate anywhere the path to samtools, is it maybe the problem related with this?
Thanks a lot,
Regards

On 25 February 2015 at 11:13, Roberto Alonso CIPF <[hidden email]> wrote:
Hello,
I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file:
Best regards

On 24 February 2015 at 17:49, Peter Cock <[hidden email]> wrote:
On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF <[hidden email]> wrote:
> Hello again,
>
> first of all thanks for your help, it is being very useful.
>
> What I have done up to now is to copy this method to the class Sequence
>
> def get_split_commands_sequential(is_compressed, input_name, output_name,
> start_sequence, sequence_count):
>         ...
>         return [cmd]
>     get_split_commands_sequential =
> staticmethod(get_split_commands_sequential)
>
> This is something that you suggested.

Good.

> When I run the tool with this configuration:
>
>
>   map with bwa
>    > split_mode="number_of_parts">
>
>   
>       bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
> $input > $output 2>/dev/null
>   
>     
>   
>   
>       
>   
>
>   
>   bwa
>   
>
>

One minor improvement would be to escape the ">" as ">" in
your XML, or use the CDATA approach documented here:

https://wiki.galaxyproject.org/Tools/BestPractices

> Everything ends ok, but when I go to check how is the sam, I see that in the
> alingments it is the path of the file, i.e
> example_split.sam:
> /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446
> 4 * 0 0 * * 0 0
> TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT
> ############################################################################
> AS:i:0 XS:i:0
>
> you know what  may be going on?
> If i don't split the file, everything goes correctly.

This sounds to me like there may be a problem with SAM merging?
Could you share the entire example_split.sam file (e.g. as a gist
on GitHub, or via dropbox)?

Peter


--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]


--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]


--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]


--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]



Connetti gratis il mondo con la nuova indoona: hai la chat, le chiamate, le video chiamate e persino le chiamate di gruppo.
E chiami gratis anche i numeri fissi e mobili nel mondo!
Scarica subito l’app Vai su https://www.indoona.com/


___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Peter Cock
In reply to this post by Roberto Alonso CIPF
On Wed, Feb 25, 2015 at 2:07 PM, Roberto Alonso CIPF <[hidden email]> wrote:

> Hello again :),
>
> I have found the problem, the code that merge the files is this:
> galaxy/datatypes/tabular.py:484:            cmd = 'egrep -v "^@" %s >> %s' %
> ( ' '.join(split_files[1:]), output_file )
> This concatenates the file name into the sam file. Just adding "h" it is
> enough, so it will be like this:
> galaxy/datatypes/tabular.py:484:            cmd = 'egrep -hv "^@" %s >> %s'
> % ( ' '.join(split_files[1:]), output_file )
>
> Thanks all for your help, best regards

Well done :)

It looks like the SAM merge needs fixing then,

$ man egrep
...
       -h, --no-filename
              Suppress  the  prefixing  of  file  names  on  output.
This is the default when there is only one file (or only standard
input) to
              search.

I filed a pull request adding the -h option to egrep, crediting you:
https://github.com/galaxyproject/galaxy/pull/4

Peter
___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Roberto Alonso CIPF
Perfect, Galaxy will also need to add the function that was deleted by merge, in 
galaxy/datatypes/sequence.py:206:  

def get_split_commands_sequential(is_compressed, input_name, output_name, start_sequence, sequence_count):
        """
        Does a brain-dead sequential scan & extract of certain sequences
        >>> Sequence.get_split_commands_sequential(True, './input.gz', './output.gz', start_sequence=0, sequence_count=10)
        ['zcat "./input.gz" | ( tail -n +1 2> /dev/null) | head -40 | gzip -c > "./output.gz"']
        >>> Sequence.get_split_commands_sequential(False, './input.fastq', './output.fastq', start_sequence=10, sequence_count=10)
        ['tail -n +41 "./input.fastq" 2> /dev/null | head -40 > "./output.fastq"']
        """
        start_line = start_sequence * 4
        line_count = sequence_count * 4
        # TODO: verify that tail can handle 64-bit numbers
        if is_compressed:
            cmd = 'zcat "%s" | ( tail -n +%s 2> /dev/null) | head -%s | gzip -c' % (input_name, start_line+1, line_count)
        else:
            cmd = 'tail -n +%s "%s" 2> /dev/null | head -%s'  % (start_line+1, input_name, line_count)
        cmd += ' > "%s"' % output_name

        return [cmd]
    get_split_commands_sequential = staticmethod(get_split_commands_sequential)

Best regards

On 25 February 2015 at 15:38, Peter Cock <[hidden email]> wrote:
On Wed, Feb 25, 2015 at 2:07 PM, Roberto Alonso CIPF <[hidden email]> wrote:
> Hello again :),
>
> I have found the problem, the code that merge the files is this:
> galaxy/datatypes/tabular.py:484:            cmd = 'egrep -v "^@" %s >> %s' %
> ( ' '.join(split_files[1:]), output_file )
> This concatenates the file name into the sam file. Just adding "h" it is
> enough, so it will be like this:
> galaxy/datatypes/tabular.py:484:            cmd = 'egrep -hv "^@" %s >> %s'
> % ( ' '.join(split_files[1:]), output_file )
>
> Thanks all for your help, best regards

Well done :)

It looks like the SAM merge needs fixing then,

$ man egrep
...
       -h, --no-filename
              Suppress  the  prefixing  of  file  names  on  output.
This is the default when there is only one file (or only standard
input) to
              search.

I filed a pull request adding the -h option to egrep, crediting you:
https://github.com/galaxyproject/galaxy/pull/4

Peter



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]

___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Peter Cock
On Wed, Feb 25, 2015 at 3:34 PM, Roberto Alonso CIPF <[hidden email]> wrote:
> Perfect, Galaxy will also need to add the function that was deleted by
> merge, in galaxy/datatypes/sequence.py

Yes - if you want to do a pull request with that, please go ahead.
Otherwise I hope to do it later this week...

Your egrep fix has been applied to the main repository now:
https://github.com/galaxyproject/galaxy/pull/4

Peter
___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/
Reply | Threaded
Open this post in threaded view
|

Re: problems splitting

Roberto Alonso CIPF
perfect, I will do the pull request.

Thanks!!

On 25 February 2015 at 16:38, Peter Cock <[hidden email]> wrote:
On Wed, Feb 25, 2015 at 3:34 PM, Roberto Alonso CIPF <[hidden email]> wrote:
> Perfect, Galaxy will also need to add the function that was deleted by
> merge, in galaxy/datatypes/sequence.py

Yes - if you want to do a pull request with that, please go ahead.
Otherwise I hope to do it later this week...

Your egrep fix has been applied to the main repository now:
https://github.com/galaxyproject/galaxy/pull/4

Peter



--
Roberto Alonso
Functional Genomics Unit
Bioinformatics and Genomics Department
Prince Felipe Research Center (CIPF)
C./Eduardo Primo Yúfera (Científic), nº 3
(junto Oceanografico)
46012 Valencia, Spain
Tel: +34 963289680 Ext. 1021
Fax: +34 963289574
E-Mail: [hidden email]

___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/